Advanced search options

Advanced Search Options 🞨

Browse by author name (“Author name starts with…”).

Find ETDs with:

in
/  
in
/  
in
/  
in

Written in Published in Earliest date Latest date

Sorted by

Results per page:

Sorted by: relevance · author · university · dateNew search

You searched for subject:(Proteorhodopsin). Showing records 1 – 17 of 17 total matches.

Search Limiters

Last 2 Years | English Only

No search limiters apply to these results.

▼ Search Limiters


Victoria University of Wellington

1. Burr, David Joll. The Light Responses of Proteorhodopsin-bearing, Antarctic Sea-ice Bacteria.

Degree: 2014, Victoria University of Wellington

 Although homogenous in appearance, Antarctic sea ice forms a complex habitat that is characterised by steep vertical gradients of temperature, irradiance and salinity. Despite these… (more)

Subjects/Keywords: Proteorhodopsin; Antarctic; Bacteria

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Burr, D. J. (2014). The Light Responses of Proteorhodopsin-bearing, Antarctic Sea-ice Bacteria. (Masters Thesis). Victoria University of Wellington. Retrieved from http://hdl.handle.net/10063/3675

Chicago Manual of Style (16th Edition):

Burr, David Joll. “The Light Responses of Proteorhodopsin-bearing, Antarctic Sea-ice Bacteria.” 2014. Masters Thesis, Victoria University of Wellington. Accessed September 18, 2020. http://hdl.handle.net/10063/3675.

MLA Handbook (7th Edition):

Burr, David Joll. “The Light Responses of Proteorhodopsin-bearing, Antarctic Sea-ice Bacteria.” 2014. Web. 18 Sep 2020.

Vancouver:

Burr DJ. The Light Responses of Proteorhodopsin-bearing, Antarctic Sea-ice Bacteria. [Internet] [Masters thesis]. Victoria University of Wellington; 2014. [cited 2020 Sep 18]. Available from: http://hdl.handle.net/10063/3675.

Council of Science Editors:

Burr DJ. The Light Responses of Proteorhodopsin-bearing, Antarctic Sea-ice Bacteria. [Masters Thesis]. Victoria University of Wellington; 2014. Available from: http://hdl.handle.net/10063/3675

2. Brown, Rachel Ellen. Adaptation of Green Proteorhodopsin to Changes in Membrane Lipid Composition.

Degree: MS, Department of Physics, 2018, University of Guelph

 The protein studied in this thesis is Proteorhodopsin (PR), which is linked to starvation states in marine bacteria. This work examines PR membrane system stability… (more)

Subjects/Keywords: Proteorhodopsin; Membrane Properties; NMR; FTIR

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Brown, R. E. (2018). Adaptation of Green Proteorhodopsin to Changes in Membrane Lipid Composition. (Masters Thesis). University of Guelph. Retrieved from https://atrium.lib.uoguelph.ca/xmlui/handle/10214/14219

Chicago Manual of Style (16th Edition):

Brown, Rachel Ellen. “Adaptation of Green Proteorhodopsin to Changes in Membrane Lipid Composition.” 2018. Masters Thesis, University of Guelph. Accessed September 18, 2020. https://atrium.lib.uoguelph.ca/xmlui/handle/10214/14219.

MLA Handbook (7th Edition):

Brown, Rachel Ellen. “Adaptation of Green Proteorhodopsin to Changes in Membrane Lipid Composition.” 2018. Web. 18 Sep 2020.

Vancouver:

Brown RE. Adaptation of Green Proteorhodopsin to Changes in Membrane Lipid Composition. [Internet] [Masters thesis]. University of Guelph; 2018. [cited 2020 Sep 18]. Available from: https://atrium.lib.uoguelph.ca/xmlui/handle/10214/14219.

Council of Science Editors:

Brown RE. Adaptation of Green Proteorhodopsin to Changes in Membrane Lipid Composition. [Masters Thesis]. University of Guelph; 2018. Available from: https://atrium.lib.uoguelph.ca/xmlui/handle/10214/14219


University of Southern California

3. Seegers, Brian Joseph. Proteorhodopsin quantification in marine bacteria by LCMS measurement of the retinal chromophore.

Degree: MS, Ocean Sciences, 2013, University of Southern California

 It is well known that proteorhodopsins (PRs) are present in microbial populations throughout the global oceans. However, no method exists for the routine quantification of… (more)

Subjects/Keywords: proteorhodopsin; retinal; bacteria; LCMS; marine; pigments

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Seegers, B. J. (2013). Proteorhodopsin quantification in marine bacteria by LCMS measurement of the retinal chromophore. (Masters Thesis). University of Southern California. Retrieved from http://digitallibrary.usc.edu/cdm/compoundobject/collection/p15799coll3/id/292876/rec/5304

Chicago Manual of Style (16th Edition):

Seegers, Brian Joseph. “Proteorhodopsin quantification in marine bacteria by LCMS measurement of the retinal chromophore.” 2013. Masters Thesis, University of Southern California. Accessed September 18, 2020. http://digitallibrary.usc.edu/cdm/compoundobject/collection/p15799coll3/id/292876/rec/5304.

MLA Handbook (7th Edition):

Seegers, Brian Joseph. “Proteorhodopsin quantification in marine bacteria by LCMS measurement of the retinal chromophore.” 2013. Web. 18 Sep 2020.

Vancouver:

Seegers BJ. Proteorhodopsin quantification in marine bacteria by LCMS measurement of the retinal chromophore. [Internet] [Masters thesis]. University of Southern California; 2013. [cited 2020 Sep 18]. Available from: http://digitallibrary.usc.edu/cdm/compoundobject/collection/p15799coll3/id/292876/rec/5304.

Council of Science Editors:

Seegers BJ. Proteorhodopsin quantification in marine bacteria by LCMS measurement of the retinal chromophore. [Masters Thesis]. University of Southern California; 2013. Available from: http://digitallibrary.usc.edu/cdm/compoundobject/collection/p15799coll3/id/292876/rec/5304


University of Tasmania

4. Feng, Shi. Is Proteorhodopsin a general light-driven stress adaptation system for survival in cold environments.

Degree: 2014, University of Tasmania

 This study aimed to achieve a better understanding of microbial adaptations in sea ice focusing on the physiological role of the light harvesting proton pump… (more)

Subjects/Keywords: Proteorhodopsin; sea-ice; proteomic; comparative geomics; evolution; life strategy

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Feng, S. (2014). Is Proteorhodopsin a general light-driven stress adaptation system for survival in cold environments. (Thesis). University of Tasmania. Retrieved from https://eprints.utas.edu.au/22486/1/front-Shi-thesis.pdf ; https://eprints.utas.edu.au/22486/2/Whole-Shi-thesis.pdf

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Chicago Manual of Style (16th Edition):

Feng, Shi. “Is Proteorhodopsin a general light-driven stress adaptation system for survival in cold environments.” 2014. Thesis, University of Tasmania. Accessed September 18, 2020. https://eprints.utas.edu.au/22486/1/front-Shi-thesis.pdf ; https://eprints.utas.edu.au/22486/2/Whole-Shi-thesis.pdf.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

MLA Handbook (7th Edition):

Feng, Shi. “Is Proteorhodopsin a general light-driven stress adaptation system for survival in cold environments.” 2014. Web. 18 Sep 2020.

Vancouver:

Feng S. Is Proteorhodopsin a general light-driven stress adaptation system for survival in cold environments. [Internet] [Thesis]. University of Tasmania; 2014. [cited 2020 Sep 18]. Available from: https://eprints.utas.edu.au/22486/1/front-Shi-thesis.pdf ; https://eprints.utas.edu.au/22486/2/Whole-Shi-thesis.pdf.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Council of Science Editors:

Feng S. Is Proteorhodopsin a general light-driven stress adaptation system for survival in cold environments. [Thesis]. University of Tasmania; 2014. Available from: https://eprints.utas.edu.au/22486/1/front-Shi-thesis.pdf ; https://eprints.utas.edu.au/22486/2/Whole-Shi-thesis.pdf

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation


University of California – Berkeley

5. Politzer, Adam Terrall. Torturing Molecular Motors: Single-Molecule Studies of Viral Packaging and Flagellar Switching.

Degree: Biophysics, 2013, University of California – Berkeley

 Molecular motors play a central role in all known living systems. Cells use them to fight the never ending battle against entropy. Motors allow cells… (more)

Subjects/Keywords: Biophysics; Molecular biology; Microbiology; chemotaxis; molecular motors; proteorhodopsin; proton motive force; single molecule

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Politzer, A. T. (2013). Torturing Molecular Motors: Single-Molecule Studies of Viral Packaging and Flagellar Switching. (Thesis). University of California – Berkeley. Retrieved from http://www.escholarship.org/uc/item/2ng1k05w

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Chicago Manual of Style (16th Edition):

Politzer, Adam Terrall. “Torturing Molecular Motors: Single-Molecule Studies of Viral Packaging and Flagellar Switching.” 2013. Thesis, University of California – Berkeley. Accessed September 18, 2020. http://www.escholarship.org/uc/item/2ng1k05w.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

MLA Handbook (7th Edition):

Politzer, Adam Terrall. “Torturing Molecular Motors: Single-Molecule Studies of Viral Packaging and Flagellar Switching.” 2013. Web. 18 Sep 2020.

Vancouver:

Politzer AT. Torturing Molecular Motors: Single-Molecule Studies of Viral Packaging and Flagellar Switching. [Internet] [Thesis]. University of California – Berkeley; 2013. [cited 2020 Sep 18]. Available from: http://www.escholarship.org/uc/item/2ng1k05w.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Council of Science Editors:

Politzer AT. Torturing Molecular Motors: Single-Molecule Studies of Viral Packaging and Flagellar Switching. [Thesis]. University of California – Berkeley; 2013. Available from: http://www.escholarship.org/uc/item/2ng1k05w

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation


University of Guelph

6. Ward, Meaghan. Solid-State NMR Studies of Solvent-Accessible Fragments of a Seven-Helical Transmembrane Protein Proteorhodopsin.

Degree: MS, Department of Physics, 2011, University of Guelph

 High–resolution multidimensional proton-detected NMR was used to study the solvent-exposed regions of a seven-helical integral membrane proton pump proteorhodopsin (PR). Fully deuterated PR samples with… (more)

Subjects/Keywords: Proteorhodopsin; solid-state NMR; magic angle spinning; Double Quantum Coherence; membrane proteins; protein-water interaction

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Ward, M. (2011). Solid-State NMR Studies of Solvent-Accessible Fragments of a Seven-Helical Transmembrane Protein Proteorhodopsin. (Masters Thesis). University of Guelph. Retrieved from https://atrium.lib.uoguelph.ca/xmlui/handle/10214/2970

Chicago Manual of Style (16th Edition):

Ward, Meaghan. “Solid-State NMR Studies of Solvent-Accessible Fragments of a Seven-Helical Transmembrane Protein Proteorhodopsin.” 2011. Masters Thesis, University of Guelph. Accessed September 18, 2020. https://atrium.lib.uoguelph.ca/xmlui/handle/10214/2970.

MLA Handbook (7th Edition):

Ward, Meaghan. “Solid-State NMR Studies of Solvent-Accessible Fragments of a Seven-Helical Transmembrane Protein Proteorhodopsin.” 2011. Web. 18 Sep 2020.

Vancouver:

Ward M. Solid-State NMR Studies of Solvent-Accessible Fragments of a Seven-Helical Transmembrane Protein Proteorhodopsin. [Internet] [Masters thesis]. University of Guelph; 2011. [cited 2020 Sep 18]. Available from: https://atrium.lib.uoguelph.ca/xmlui/handle/10214/2970.

Council of Science Editors:

Ward M. Solid-State NMR Studies of Solvent-Accessible Fragments of a Seven-Helical Transmembrane Protein Proteorhodopsin. [Masters Thesis]. University of Guelph; 2011. Available from: https://atrium.lib.uoguelph.ca/xmlui/handle/10214/2970

7. Clayton, Jessica Ann. High-field CW EPR with Gd(III) spin labels for structure studies of membrane proteins.

Degree: 2017, University of California – eScholarship, University of California

 Electron paramagnetic resonance (EPR) in combination with site-directed spin labeling (SDSL) is a powerful tool for elucidating the structure, organization, and dynamics of biomolecules in… (more)

Subjects/Keywords: Physics; Physical chemistry; electron paramagnetic resonance; electron spin resonance; gadolinium; proteorhodopsin; zero-field splitting

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Clayton, J. A. (2017). High-field CW EPR with Gd(III) spin labels for structure studies of membrane proteins. (Thesis). University of California – eScholarship, University of California. Retrieved from http://www.escholarship.org/uc/item/9783p493

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Chicago Manual of Style (16th Edition):

Clayton, Jessica Ann. “High-field CW EPR with Gd(III) spin labels for structure studies of membrane proteins.” 2017. Thesis, University of California – eScholarship, University of California. Accessed September 18, 2020. http://www.escholarship.org/uc/item/9783p493.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

MLA Handbook (7th Edition):

Clayton, Jessica Ann. “High-field CW EPR with Gd(III) spin labels for structure studies of membrane proteins.” 2017. Web. 18 Sep 2020.

Vancouver:

Clayton JA. High-field CW EPR with Gd(III) spin labels for structure studies of membrane proteins. [Internet] [Thesis]. University of California – eScholarship, University of California; 2017. [cited 2020 Sep 18]. Available from: http://www.escholarship.org/uc/item/9783p493.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Council of Science Editors:

Clayton JA. High-field CW EPR with Gd(III) spin labels for structure studies of membrane proteins. [Thesis]. University of California – eScholarship, University of California; 2017. Available from: http://www.escholarship.org/uc/item/9783p493

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

8. Kalmbach, Rolf. In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine.

Degree: 2005, Technische Universität Dortmund

 The completion of the human genome project and the development of sensitive high-throughput assay techniques initiated a dramatic acceleration in the pace of biological research.… (more)

Subjects/Keywords: archaebacteria; Archaebakterien; bacteriorhodopsin; Bakteriorhodopsin; black lipid membrane; Black Lipid Membrane; BLM; BLM; cell-free synthesis; eubacteria; Eubakterien; GPCRs; GPCRs; G-protein coupled receptors; G-Protein gekoppelte Rezeptoren; In vitro Expression; In vitro expression; Laserblitzphotolyse; laserflash-photolysis; Liposomen; liposomes; photocycle; Photozyklus; proteorhodopsin; Proteorhodopsin; Rhodopsine; rhodopsins; Zellfreie Synthese; 610

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Kalmbach, R. (2005). In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine. (Thesis). Technische Universität Dortmund. Retrieved from http://hdl.handle.net/2003/21522

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Chicago Manual of Style (16th Edition):

Kalmbach, Rolf. “In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine.” 2005. Thesis, Technische Universität Dortmund. Accessed September 18, 2020. http://hdl.handle.net/2003/21522.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

MLA Handbook (7th Edition):

Kalmbach, Rolf. “In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine.” 2005. Web. 18 Sep 2020.

Vancouver:

Kalmbach R. In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine. [Internet] [Thesis]. Technische Universität Dortmund; 2005. [cited 2020 Sep 18]. Available from: http://hdl.handle.net/2003/21522.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Council of Science Editors:

Kalmbach R. In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine. [Thesis]. Technische Universität Dortmund; 2005. Available from: http://hdl.handle.net/2003/21522

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation


Leiden University

9. Ganapathy, S. Improvisations in phototrophy. Protein engineering and functional investigation of rhodopsin proton-pumps.

Degree: 2017, Leiden University

 Microbial rhodopsins are photosensitive pigments implemented in the growth and adaptation of a large population of microorganisms. These relatively simple, tunable photosystems use a molecule… (more)

Subjects/Keywords: Phototrophy; Microbial rhodopsin; Proteorhodopsin; Proton pump; Spectral tuning; Retinal analog; Protein engineering; Mutagenesis; Directed evolution microenvironment; Phototrophy; Microbial rhodopsin; Proteorhodopsin; Proton pump; Spectral tuning; Retinal analog; Protein engineering; Mutagenesis; Directed evolution microenvironment

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Ganapathy, S. (2017). Improvisations in phototrophy. Protein engineering and functional investigation of rhodopsin proton-pumps. (Doctoral Dissertation). Leiden University. Retrieved from http://hdl.handle.net/1887/57985

Chicago Manual of Style (16th Edition):

Ganapathy, S. “Improvisations in phototrophy. Protein engineering and functional investigation of rhodopsin proton-pumps.” 2017. Doctoral Dissertation, Leiden University. Accessed September 18, 2020. http://hdl.handle.net/1887/57985.

MLA Handbook (7th Edition):

Ganapathy, S. “Improvisations in phototrophy. Protein engineering and functional investigation of rhodopsin proton-pumps.” 2017. Web. 18 Sep 2020.

Vancouver:

Ganapathy S. Improvisations in phototrophy. Protein engineering and functional investigation of rhodopsin proton-pumps. [Internet] [Doctoral dissertation]. Leiden University; 2017. [cited 2020 Sep 18]. Available from: http://hdl.handle.net/1887/57985.

Council of Science Editors:

Ganapathy S. Improvisations in phototrophy. Protein engineering and functional investigation of rhodopsin proton-pumps. [Doctoral Dissertation]. Leiden University; 2017. Available from: http://hdl.handle.net/1887/57985

10. Abad, Sadegh Faramarzi Ganj. Molecular Dynamics and Nonlinear Dynamics Studies of Chemical Systems.

Degree: PhD, Chemistry, 2018, West Virginia University

Subjects/Keywords: Molecular Dynamics Simulations; Proteorhodopsin; Surfactants; Photosensitive BZ reaction; Phase Response Curves; Synchronization; Chimera States

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Abad, S. F. G. (2018). Molecular Dynamics and Nonlinear Dynamics Studies of Chemical Systems. (Doctoral Dissertation). West Virginia University. Retrieved from https://doi.org/10.33915/etd.7149 ; https://researchrepository.wvu.edu/etd/7149

Chicago Manual of Style (16th Edition):

Abad, Sadegh Faramarzi Ganj. “Molecular Dynamics and Nonlinear Dynamics Studies of Chemical Systems.” 2018. Doctoral Dissertation, West Virginia University. Accessed September 18, 2020. https://doi.org/10.33915/etd.7149 ; https://researchrepository.wvu.edu/etd/7149.

MLA Handbook (7th Edition):

Abad, Sadegh Faramarzi Ganj. “Molecular Dynamics and Nonlinear Dynamics Studies of Chemical Systems.” 2018. Web. 18 Sep 2020.

Vancouver:

Abad SFG. Molecular Dynamics and Nonlinear Dynamics Studies of Chemical Systems. [Internet] [Doctoral dissertation]. West Virginia University; 2018. [cited 2020 Sep 18]. Available from: https://doi.org/10.33915/etd.7149 ; https://researchrepository.wvu.edu/etd/7149.

Council of Science Editors:

Abad SFG. Molecular Dynamics and Nonlinear Dynamics Studies of Chemical Systems. [Doctoral Dissertation]. West Virginia University; 2018. Available from: https://doi.org/10.33915/etd.7149 ; https://researchrepository.wvu.edu/etd/7149


Vrije Universiteit Amsterdam

11. Rupenyan, A.V. Reaction pathways in photoactive proteins .

Degree: 2009, Vrije Universiteit Amsterdam

Subjects/Keywords: proteins; photoactive; light; femtosecond spectroscopy; chromophore; vibrational spectroscopy; structural change; conformation; excited state; proteorhodopsin; Cytochrome P450; photoactive yellow protein

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Rupenyan, A. V. (2009). Reaction pathways in photoactive proteins . (Doctoral Dissertation). Vrije Universiteit Amsterdam. Retrieved from http://hdl.handle.net/1871/26389

Chicago Manual of Style (16th Edition):

Rupenyan, A V. “Reaction pathways in photoactive proteins .” 2009. Doctoral Dissertation, Vrije Universiteit Amsterdam. Accessed September 18, 2020. http://hdl.handle.net/1871/26389.

MLA Handbook (7th Edition):

Rupenyan, A V. “Reaction pathways in photoactive proteins .” 2009. Web. 18 Sep 2020.

Vancouver:

Rupenyan AV. Reaction pathways in photoactive proteins . [Internet] [Doctoral dissertation]. Vrije Universiteit Amsterdam; 2009. [cited 2020 Sep 18]. Available from: http://hdl.handle.net/1871/26389.

Council of Science Editors:

Rupenyan AV. Reaction pathways in photoactive proteins . [Doctoral Dissertation]. Vrije Universiteit Amsterdam; 2009. Available from: http://hdl.handle.net/1871/26389

12. Malmerberg, Erik. Conformational Dynamics of Rhodopsins Visualized by Time-resolved Wide Angle X-ray Scattering.

Degree: 2011, University of Gothenburg / Göteborgs Universitet

 Rhodopsins are a family of light-sensitive proteins found in the cellular membranes of a wide range of living organisms. These membrane proteins share a common… (more)

Subjects/Keywords: Time-resolved wide Angle X-ray Scattering; Retinylidene proteins; Rhodopsin; Bacteriorhodopsin; Proteorhodopsin

proteorhodopsin: A seven-transmembrane proton pump. Protein Expr Purif, 58, 103-113. Paper VII… …4 1.2.2 Proteorhodopsin… …34 3.2 Conformational acceleration in iodoretinal-substituted proteorhodopsin (Paper… …x29; n-octyl-β-D-glucopyranoside Picosecond (10-12 s) Proteorhodopsin Visual… …proteorhodopsin) and one type 2 rhodopsin (visual rhodopsin). 3 Conformational… 

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Malmerberg, E. (2011). Conformational Dynamics of Rhodopsins Visualized by Time-resolved Wide Angle X-ray Scattering. (Thesis). University of Gothenburg / Göteborgs Universitet. Retrieved from http://hdl.handle.net/2077/27026

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Chicago Manual of Style (16th Edition):

Malmerberg, Erik. “Conformational Dynamics of Rhodopsins Visualized by Time-resolved Wide Angle X-ray Scattering.” 2011. Thesis, University of Gothenburg / Göteborgs Universitet. Accessed September 18, 2020. http://hdl.handle.net/2077/27026.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

MLA Handbook (7th Edition):

Malmerberg, Erik. “Conformational Dynamics of Rhodopsins Visualized by Time-resolved Wide Angle X-ray Scattering.” 2011. Web. 18 Sep 2020.

Vancouver:

Malmerberg E. Conformational Dynamics of Rhodopsins Visualized by Time-resolved Wide Angle X-ray Scattering. [Internet] [Thesis]. University of Gothenburg / Göteborgs Universitet; 2011. [cited 2020 Sep 18]. Available from: http://hdl.handle.net/2077/27026.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Council of Science Editors:

Malmerberg E. Conformational Dynamics of Rhodopsins Visualized by Time-resolved Wide Angle X-ray Scattering. [Thesis]. University of Gothenburg / Göteborgs Universitet; 2011. Available from: http://hdl.handle.net/2077/27026

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

13. Stening, Marcus. Jämförelse av genexpression mellan isolat av Dokdonia MED134 som tillvuxit i konstant ljus kontra konstant mörker med qPCR.

Degree: Chemistry and Biomedical Sciences, 2018, Linnaeus University

  Marine bacteria play an important role in the marine nutrition cycles. About half of all sea-living bacteria can use light as an energy source,… (more)

Subjects/Keywords: qPCR; PCR; Dokdonia MED134; Proteorhodopsin; isocitratdehydrogenas; Biomedical Laboratory Science/Technology; Biomedicinsk laboratorievetenskap/teknologi

…en skillnad i genutryck för proteorhodopsin och isocitratdehydrogenas i Dokdonia… …proteorhodopsin, isocitratdehydrogenas, RpoD och RecA. Gen Forward primer Reverse primer… …Proteorhodopsin AACCGGATACATAGGCGAAG ACAGCTCCACCTGCCCTTAC Isocitratdehydrogenas AGTATGGGTGCTTGGAGTGC… …produkt av generna proteorhodopsin, isocitratdehydrogenas samt housekeepinggenerna RpoD och RecA… …x28;Figur 7-10). Smältkurva visade även på eventuell primerdimer för proteorhodopsin på… 

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Stening, M. (2018). Jämförelse av genexpression mellan isolat av Dokdonia MED134 som tillvuxit i konstant ljus kontra konstant mörker med qPCR. (Thesis). Linnaeus University. Retrieved from http://urn.kb.se/resolve?urn=urn:nbn:se:lnu:diva-78588

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Chicago Manual of Style (16th Edition):

Stening, Marcus. “Jämförelse av genexpression mellan isolat av Dokdonia MED134 som tillvuxit i konstant ljus kontra konstant mörker med qPCR.” 2018. Thesis, Linnaeus University. Accessed September 18, 2020. http://urn.kb.se/resolve?urn=urn:nbn:se:lnu:diva-78588.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

MLA Handbook (7th Edition):

Stening, Marcus. “Jämförelse av genexpression mellan isolat av Dokdonia MED134 som tillvuxit i konstant ljus kontra konstant mörker med qPCR.” 2018. Web. 18 Sep 2020.

Vancouver:

Stening M. Jämförelse av genexpression mellan isolat av Dokdonia MED134 som tillvuxit i konstant ljus kontra konstant mörker med qPCR. [Internet] [Thesis]. Linnaeus University; 2018. [cited 2020 Sep 18]. Available from: http://urn.kb.se/resolve?urn=urn:nbn:se:lnu:diva-78588.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Council of Science Editors:

Stening M. Jämförelse av genexpression mellan isolat av Dokdonia MED134 som tillvuxit i konstant ljus kontra konstant mörker med qPCR. [Thesis]. Linnaeus University; 2018. Available from: http://urn.kb.se/resolve?urn=urn:nbn:se:lnu:diva-78588

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

14. Kalmbach, Rolf. In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine.

Degree: 2005, Technische Universität Dortmund

 The completion of the human genome project and the development of sensitive high-throughput assay techniques initiated a dramatic acceleration in the pace of biological research.… (more)

Subjects/Keywords: In vitro Expression; Zellfreie Synthese; Liposomen; Archaebakterien; Eubakterien; Rhodopsine; G-Protein gekoppelte Rezeptoren; GPCRs; Bakteriorhodopsin; Proteorhodopsin; Black Lipid Membrane; BLM; Laserblitzphotolyse; Photozyklus; In vitro expression; cell-free synthesis; liposomes; archaebacteria; eubacteria; rhodopsins; G-protein coupled receptors; GPCRs; bacteriorhodopsin; proteorhodopsin; black lipid membrane; BLM; laserflash-photolysis; photocycle; 610

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Kalmbach, R. (2005). In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine. (Doctoral Dissertation). Technische Universität Dortmund. Retrieved from http://dx.doi.org/10.17877/DE290R-14176

Chicago Manual of Style (16th Edition):

Kalmbach, Rolf. “In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine.” 2005. Doctoral Dissertation, Technische Universität Dortmund. Accessed September 18, 2020. http://dx.doi.org/10.17877/DE290R-14176.

MLA Handbook (7th Edition):

Kalmbach, Rolf. “In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine.” 2005. Web. 18 Sep 2020.

Vancouver:

Kalmbach R. In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine. [Internet] [Doctoral dissertation]. Technische Universität Dortmund; 2005. [cited 2020 Sep 18]. Available from: http://dx.doi.org/10.17877/DE290R-14176.

Council of Science Editors:

Kalmbach R. In vivo und in vitro Expression von Membranproteinen am Beispiel archae- und eubakterieller Rhodopsine. [Doctoral Dissertation]. Technische Universität Dortmund; 2005. Available from: http://dx.doi.org/10.17877/DE290R-14176

15. O'Halloran, Matthew. Use of a Paramagnetic Spin Label for Determination of Long-Range Distance Constraints in Solid-State NMR.

Degree: MS, Department of Physics, 2014, University of Guelph

 Solid-State Nuclear Magnetic Resonance (SSNMR), with paramagnetic relaxation enhancement (PRE), is used to investigate the protein Proteorhodopsin (PR). PRE allows for the acquisition of long-range… (more)

Subjects/Keywords: Solid State Nuclear Magnetic Resonance (SSNMR); Paramagnetic Relaxation Enhancement (PRE); Membrane Proteins; Proteorhodopsin (PR); Site Specific Labelling

…transducer that is thought to affect gene expression [15]. Proteorhodopsin (PR)… …here [16,17]. 1.3 Proteorhodopsin Proteorhodopsins were first discovered through… …of host cells with or without PR [49]. 1.3.1 Proteorhodopsin proton pumping… …PR. Figure 1-1: Structural model of bacteriorhodopsin [A] and proteorhodopsin… …structure. 1.3.2 Proteorhodopsin Structural Studies Due to the wide dispersion of organisms in… 

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

O'Halloran, M. (2014). Use of a Paramagnetic Spin Label for Determination of Long-Range Distance Constraints in Solid-State NMR. (Masters Thesis). University of Guelph. Retrieved from https://atrium.lib.uoguelph.ca/xmlui/handle/10214/8278

Chicago Manual of Style (16th Edition):

O'Halloran, Matthew. “Use of a Paramagnetic Spin Label for Determination of Long-Range Distance Constraints in Solid-State NMR.” 2014. Masters Thesis, University of Guelph. Accessed September 18, 2020. https://atrium.lib.uoguelph.ca/xmlui/handle/10214/8278.

MLA Handbook (7th Edition):

O'Halloran, Matthew. “Use of a Paramagnetic Spin Label for Determination of Long-Range Distance Constraints in Solid-State NMR.” 2014. Web. 18 Sep 2020.

Vancouver:

O'Halloran M. Use of a Paramagnetic Spin Label for Determination of Long-Range Distance Constraints in Solid-State NMR. [Internet] [Masters thesis]. University of Guelph; 2014. [cited 2020 Sep 18]. Available from: https://atrium.lib.uoguelph.ca/xmlui/handle/10214/8278.

Council of Science Editors:

O'Halloran M. Use of a Paramagnetic Spin Label for Determination of Long-Range Distance Constraints in Solid-State NMR. [Masters Thesis]. University of Guelph; 2014. Available from: https://atrium.lib.uoguelph.ca/xmlui/handle/10214/8278

16. Munro, Rachel. Investigations into the production of integral membrane proteins for solid-state NMR spectroscopy.

Degree: MS, Department of Physics, 2016, University of Guelph

 This study seeks to probe the challenges associated with heterologous expression and isotopic labeling of microbial rhodopsins and the GPCR adenosine receptor (2A) (A2aR) through… (more)

Subjects/Keywords: Research Subject Categories::NATURAL SCIENCES::Chemistry::Molecular biophysics; Nuclear Magentic Resonance; Integral membrane proteins; Isotopic Labeling; Adenosine receptor (2A); Anabaena Sensory Rhodopsin; Proteorhodopsin; Retinal; Solid-state NMR

…41 FIGURE 14 – 1D SSNMR SPECTRA OF 15N-334-A2AR (BLACK), PROTEORHODOPSIN (… 

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Munro, R. (2016). Investigations into the production of integral membrane proteins for solid-state NMR spectroscopy. (Masters Thesis). University of Guelph. Retrieved from https://atrium.lib.uoguelph.ca/xmlui/handle/10214/9460

Chicago Manual of Style (16th Edition):

Munro, Rachel. “Investigations into the production of integral membrane proteins for solid-state NMR spectroscopy.” 2016. Masters Thesis, University of Guelph. Accessed September 18, 2020. https://atrium.lib.uoguelph.ca/xmlui/handle/10214/9460.

MLA Handbook (7th Edition):

Munro, Rachel. “Investigations into the production of integral membrane proteins for solid-state NMR spectroscopy.” 2016. Web. 18 Sep 2020.

Vancouver:

Munro R. Investigations into the production of integral membrane proteins for solid-state NMR spectroscopy. [Internet] [Masters thesis]. University of Guelph; 2016. [cited 2020 Sep 18]. Available from: https://atrium.lib.uoguelph.ca/xmlui/handle/10214/9460.

Council of Science Editors:

Munro R. Investigations into the production of integral membrane proteins for solid-state NMR spectroscopy. [Masters Thesis]. University of Guelph; 2016. Available from: https://atrium.lib.uoguelph.ca/xmlui/handle/10214/9460


Université de Montréal

17. Nguyen, Dan. Patrons saisonniers de transformation du carbone et efficacité métabolique des communautés bactériennes du golfe d’Amundsen, Arctique canadien.

Degree: 2015, Université de Montréal

Subjects/Keywords: glaces de mer; biogéochimie; cycle du carbone; patrons saisonniers; production bactérienne; respiration; efficacité de croissance; diversité fonctionnelle; Océan Arctique; protéorhodopsine; Arctic ocean; Sea-ice; biogeochemistry; Carbon cycling; seasonal patterns; bacterial production; growth efficiency; functional diversity; proteorhodopsin; Biology - Oceanography / Biologie - Océanographie (UMI : 0416)

Record DetailsSimilar RecordsGoogle PlusoneFacebookTwitterCiteULikeMendeleyreddit

APA · Chicago · MLA · Vancouver · CSE | Export to Zotero / EndNote / Reference Manager

APA (6th Edition):

Nguyen, D. (2015). Patrons saisonniers de transformation du carbone et efficacité métabolique des communautés bactériennes du golfe d’Amundsen, Arctique canadien. (Thesis). Université de Montréal. Retrieved from http://hdl.handle.net/1866/11449

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Chicago Manual of Style (16th Edition):

Nguyen, Dan. “Patrons saisonniers de transformation du carbone et efficacité métabolique des communautés bactériennes du golfe d’Amundsen, Arctique canadien.” 2015. Thesis, Université de Montréal. Accessed September 18, 2020. http://hdl.handle.net/1866/11449.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

MLA Handbook (7th Edition):

Nguyen, Dan. “Patrons saisonniers de transformation du carbone et efficacité métabolique des communautés bactériennes du golfe d’Amundsen, Arctique canadien.” 2015. Web. 18 Sep 2020.

Vancouver:

Nguyen D. Patrons saisonniers de transformation du carbone et efficacité métabolique des communautés bactériennes du golfe d’Amundsen, Arctique canadien. [Internet] [Thesis]. Université de Montréal; 2015. [cited 2020 Sep 18]. Available from: http://hdl.handle.net/1866/11449.

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

Council of Science Editors:

Nguyen D. Patrons saisonniers de transformation du carbone et efficacité métabolique des communautés bactériennes du golfe d’Amundsen, Arctique canadien. [Thesis]. Université de Montréal; 2015. Available from: http://hdl.handle.net/1866/11449

Note: this citation may be lacking information needed for this citation format:
Not specified: Masters Thesis or Doctoral Dissertation

.